This was posted 9 years 11 months 6 days ago, and might be an out-dated deal.

Related
  • expired

Celebrate Scientific Milestones with a Free DNA Anniversary T-Shirt

1900
Celebrate Scientific Milestones with a Free DNA Anniversary T-Shirt
Go to Deal
lukeloop on 22/05/2014 - 20:57 lifetechnologies.com (8833 clicks)
Last edited 23/05/2014 - 15:32

Get your gear off… I mean on..grab a free t-shirt. Don't get yourself into a helix.
Here is a link of what it looks like.

http://tools.lifetechnologies.com/imglibrary/EM16879-Amplify…

Enjoy.. TGTGCACATACTCACGTCACTCTGCTCAGCCACGATATCCTATGA

Fashion & Apparel Dna T-Shirt T-Shirt

Related Stores

lifetechnologies.com
lifetechnologies.com

closed Comments

  • DealzEddy123 on 22/05/2014 - 21:02

    thankss

  • scrimshaw on 22/05/2014 - 21:18
    +2

    ATGCGATTTCGGATTAA

    I think you forgot the X and Y letters there.

  • lukeloop on 22/05/2014 - 21:19
    +2

    Yes the new base pairs. interesting.

  • jasopan on 22/05/2014 - 21:22

    Nice looking shirt. I ordered a Large, but have no idea on the actual sizing.

  • Goatku on 22/05/2014 - 21:26

    Thanks!

  • GnarlyKnuckles on 22/05/2014 - 21:37
    +1

    I thought you'd cleverly written us a short message in code lukes… imagine my disappointment to discover you'd written "MAFRI-AA".
    TGTCGTGCTCCTCCTTAT, ATGGCTAAT ;-(

    LOL

    • lukeloop on 23/05/2014 - 15:32

      OK, I have changed the code to say something now.

      TGTGCACATACTCACGTCACTCTGCTCAGCCACGATATCCTATGA

      • GnarlyKnuckles on 24/05/2014 - 02:12

        Erm… now it says "CAHTHVTLLSHDIL"… which is "something" I guess, but I don't think anyone would deem it an improvement…
        Nevermind Lukozade, if the T-shirt arrives, I'll forgive ya!
        You'd better hope those dudes dishing out the "Ts" ain't reading this forum though… With DNA-translation errors like that, they'll see right through ya!
        It'll be like that old Sienfeld episode…
        NO SHIRT FOR YOU!!;-<

        lololol

        • lukeloop on 24/05/2014 - 02:20

          use this to translate base sequence to text
          http://earthsciweb.org/js/bio/dna-writer/

        • GnarlyKnuckles on 24/05/2014 - 02:39

          Erm… no thanks, I'll stick to actual codons… messing with that age old formula is a surefire invitation to bring on Mr Disaster himself…&-<

          You'll thank me one day, grasshopper…

  • Peck on 22/05/2014 - 21:38
    +1

    The application form looks like you are supposed to work for a department involved in DNA work!

    • 0solvalou on 22/05/2014 - 21:43
      +11

      Don't we all? ;-)

      • Peck on 22/05/2014 - 21:49

        OH! Gotcha! Wink Wink!!

      • Jared17 on 22/05/2014 - 21:52
        +3

        I'm Dr Art Vandelay from BS Genome Institute, nice to meet you.

        • scrimshaw on 22/05/2014 - 23:34
          +7

          Guess I'm Dr Gordon Freeman from the Black Mesa institute then.

        • pyro love bird on 23/05/2014 - 01:23
          -3

          Do you mean MENSA?

        • illz on 23/05/2014 - 08:39
          +1

          No, it's MESA

        • pyro love bird on 25/05/2014 - 13:00
          -1

          Okay, my bad, I've just not heard of it before, no need to neg me for asking a question…

      • Nirraic on 23/05/2014 - 11:07
        +2

        I thought so, I'm a Managing Direcor at OzBargain Labs.

  • GnarlyKnuckles on 22/05/2014 - 21:45
    +1

    Did you say "aMpliFication form" ? ;-)

  • sydozbargain0000 on 22/05/2014 - 21:51
    +13

    Gattaca— One of the most thought provoking and inspiring films ever made. Highly recommended if you haven't seen it already!

    https://www.youtube.com/watch?v=ZppWok6SX88

    • Jared17 on 22/05/2014 - 21:54
      +3

      I love that film. Awesome soundtrack too.

      There is no gene for the human spirit!

    • Boodek on 22/05/2014 - 22:02
      +1

      I use it every year when we are doing ethics with my Year 11 RE classes. Great resource.

    • Almost Banned on 23/05/2014 - 10:57

      Not only is it a fantastic film with a very intriguing message but it has a very cool stylistic look.
      It is one of the very few I have actually bought the DVD!

    • PVA on 01/06/2014 - 17:51

      Great movie.

  • Leonard on 22/05/2014 - 21:52
    +12

    Yup! I've become a Department Head in Nucleic Acid Purification and Separation and I'll be buying a device for Whole Genome Sequencing! Of course I'll require a Large T-shirt to go with my new ego..

  • tsunamisurfer on 22/05/2014 - 22:04
    +1

    Anyone else the Chief Scientist at Jurassic Park?

    • [Deactivated] on 22/05/2014 - 22:06
      +1

      How can you be Chief Scientist if I am already Chief Scientist?

      • IHateFrasierCrane on 22/05/2014 - 22:09
        +2

        Henry Wu obviously did a shit job, maybe you can do better.

        (profanity) frogs.

  • Boodek on 22/05/2014 - 22:10

    I have no idea which boxes I ticked to receive my tee-shirt, but I feel very important now. Thanks, OP.

  • [Deactivated] on 22/05/2014 - 22:10
    +24

    now i can spot OzBargainers on the train and talk to them about Eneloop deals, success.

    • Peck on 23/05/2014 - 00:12

      hehehe !! gave me a good belly larf!!

  • [Deactivated] on 22/05/2014 - 22:13
    +1

    "Get your gear off… I mean on..grab a free t-shirt. Don't get yourself into a helix."

    The puns itself deserves an upvote.

  • garetz on 22/05/2014 - 22:23
    +1

    This offer is full of weight-based discrimination, only goes up to size L.

    • Almost Banned on 23/05/2014 - 10:58

      How many lab rats do you think need an XL or above?

  • scar4ace on 22/05/2014 - 22:28
    +7

    Hmmm will they actually deliver to oz? Lol

    I think they'll get a ill suspicious when this sudden influx of "scientists" from Australia start requesting tshirts

    • El Hefe on 22/05/2014 - 22:58
      +27

      Particularly since we don't actually believe in science in Australia any more.

      • compound on 23/05/2014 - 00:30
        +1

        Not with our dearly beloved king and feudal lords running the place.

      • Almost Banned on 23/05/2014 - 10:59
        +1

        You mean, of course, except for the $20B medical research fund…
        right?

  • nahi11 on 22/05/2014 - 22:54

    The chances of getting these t-shirts are very minimal. I don't think they were expecting the ozbargain type of professionals to sign up.

    • GnarlyKnuckles on 24/05/2014 - 21:13
      +1

      Well, methinks they'd be wise to "come to the party" regardless; Hell hath no fury like the OzB' community, when it emerges that they've had their time wasted, chasing an empty promise…
      I mean look at what happened to poor old Gearbest with that headlight-thingy debacle!?! That was hilarious (although not for the poor sap/s who got the blame for it at their end, no doubt!), the wailing and gnashing of teeth that went on when the greedy peeps who suddenly required 48 head-torches realised they weren't actually going to get them … (at least not for ~$48 bucks!). But I digress. Again.
      Anyways, I reckon the T-shirts will come. These drug/research-materials companies have so much cash availablel for "promotions", it's unbelievable. And LONG LIVE the (somewhat sudden) increase in the number of genetics scientists in Australia. That 20B fund should help sponsor all our research programs, no worries. We've always been a very adaptable bunch… It's coz of our convict heritage, you know…

  • Steptoe on 22/05/2014 - 22:55
    +1

    Better than the DNA Dress I got last time this was offered

  • PJC on 22/05/2014 - 23:56
    +1

    Quite a good post, but too many lies for a T-shirt.

    • compound on 23/05/2014 - 00:31

      Do you work for ICAC?

    • Almost Banned on 23/05/2014 - 11:01
      +5

      Sadly I have to agree.
      I wanted the t-shirt but when I started to fill out the form I just couldn't do it.
      My integrity is worth more to me than the t-shirt is.

      • GnarlyKnuckles on 24/05/2014 - 21:21
        +3

        As luck would have it I actually DO work in a lot of the capacities represented by those boxes… for anyone who does not though, and wants a T-shirt "guilt free", I advise checking one box only. The "tissue culture" one. Anyone that eats food, and/or drinks water, is actively partaking in "tissue culture". Sort of.
        OK look at it this way, I'm guessing the guilt is derived from some sort of religious affiliation (it usually is), and everyone knows that god hates DNA; cause it's like, been at the root of screwing with a lot of his "original creations" lately… (cloning, GM food, gene-therapy, etc.). Personally, I reckon god is probably actually responsible for leaking this deal to OzB in the first place. So go forth, guilt-free.

  • BH1 on 23/05/2014 - 05:20

    No he works for "GATTACA" :)

  • smarter_fool on 23/05/2014 - 07:22

    This will make me look "intelligent".
    I am tots interested. Thanks OP.

  • CrocDundee on 23/05/2014 - 08:00
    +2

    I probably shouldn't have put "Ozbargain" in the place it asks "How did you hear about us" lol…

    • sk3iron on 23/05/2014 - 09:52
      +2

      Probably not

      • StewBalls on 23/05/2014 - 10:30
        +10

        There's probably more scientists on OzB than at CSIRO now…

    • GnarlyKnuckles on 24/05/2014 - 21:33

      Hahaha-Tuha, hilarious Bro :) I don't reckon they actually care who walks around with the T-shirts on, as long as it's lots of peeps. And this way their brand-name will penetrate all walks of life/ social circles. I mean, even the manufacturers of "unauthorised recreational pharmaceuticals" (crystal meth, for example) need lab equipment…

  • altomic on 23/05/2014 - 08:03

    I've got science for every occasion. postulating theorems, formulating equations.

  • Godric on 23/05/2014 - 08:19

    No phone number i put in works ><

    • nickj on 23/05/2014 - 10:37

      A standard mobile number worked for me … perhaps you need more digits, or to drop the country code and plus sign?

      • Godric on 23/05/2014 - 19:43

        Turns out i didn't have my email entered in, i thought it was giving me an error to my phone number :P

        Cheers though

    • GnarlyKnuckles on 24/05/2014 - 21:40

      Did you try your actual phone number? Mine worked no worries. And it's not like they're likely to actually ring ya'. I really hope they do ring me though. I already have a series of "Jerky boys/ Crank-Yankers" style gags ready and waiting for them… Ahhh, DNA research… such fertile ground for mad scientist-type leg-pulling phone-gags… and provided they call you, it's perfectly legal.

  • [Deactivated] on 23/05/2014 - 08:44

    No 'Fat Bastard' size 8-(

    • GnarlyKnuckles on 24/05/2014 - 21:41
      +1

      Size 8 is actually pretty small man. ;P

  • AnophthalmiaCervidae on 23/05/2014 - 10:14
    +5

    I'm expecting my T-shirt too arrive just after I get my Chubb fire blanket.

    https://www.ozbargain.com.au/node/137320

    • Steptoe on 23/05/2014 - 17:57
      +1

      …and Bottle of Brake Fluid

      • Consumer Sheep on 24/05/2014 - 13:46

        Mouse from BigW
        $10 discount from Anaconda
        A heap of crap from DX….

      • ShipShapeRC on 27/05/2014 - 08:41
        +1

        I use a custom email address so I can track who shares addresses. Never got my bloody brake fluid but I get spam to that email address now - thanks brakes direct.

  • cpho on 23/05/2014 - 10:47
    +9

    Awesome! Finally have a use for my B.Sci!

  • Pooky1 on 23/05/2014 - 12:18
    +3

    Thanks OP. Im actually a Biology teacher so I didn't need to lie too much ;)

  • DEvok on 23/05/2014 - 13:47

    I work dr bla and work in the institution of RTA of sydney 0.o

  • ramsheed on 23/05/2014 - 19:59

    Yay I actually work in med science and use Lifetech stuff all the time, better come through…

  • Frantic on 25/05/2014 - 13:40
    +9

    Hmm.. shouldn't have put my real ph number.. got a call asking how my bio-nuclear stem cell regrowth research was progressing and whether type-a blood cells take to nanoplasmic organism tissue growth? Had to stall em for a bit till I did some googling and formulated a satisfactory answer.. damn hope I get my t-shirt now..

    • altomic on 25/05/2014 - 22:56
      +7

      same thing happened to me with the Poise samples….

    • GnarlyKnuckles on 01/06/2014 - 02:50

      Chuckle, hilarious gag Franny, I'm considering generating a second OB identity JUST so that I can "PLUS" this comment twice!

  • PVA on 01/06/2014 - 17:56

    looks like not available now…

    Page not found
    404
    We're sorry,
    this page is not available

    Please let us know and we will get it fixed.

  • treeman on 10/06/2014 - 08:21

    Did anyone receive theirs?

  • GnarlyKnuckles on 18/06/2014 - 21:42

    Nope. No one. It kinda' makes you not want to order anything from them, frankly… 1000s of T-shirts ordered, none delivered… I wonder if they're like that with their reagents?!?

  • Jared17 on 20/06/2014 - 09:47

    Not heard anything from them. Oh well

Login or Join to leave a comment
Login Join